Para entender de genómica y algo más

María de los Ángeles Valdés Ramírez y Erika Acosta Cruz

Antes pensábamos que nuestro futuro estaba en las estrellas.

Ahora sabemos que está en nuestros genes.

-James Watson

 

En el siglo XXI es común escuchar las palabras adn, genes, genomas, mejoramiento genético y muchas otras, ya que éstas han llegado a películas, se­ries de televisión e incluso libros de ciencia ficción. La secuenciación de genomas es hoy en día algo de rutina en muchos centros de inves­tigación y motor de avances científicos en muy diferen­tes rubros como el ecológico, el agronómico, en ciencias alimenticias y de la salud, por lo que conviene recor­dar y tener claros algunos conceptos para poder darles el valor y la importancia adecuados.

*Programa en Biomedicina y Biotecno­logía Molecular de la ENCB del IPN.

¿Qué es el adn?

El adn o dna, es el ácido desoxirribo­nucleico, molécula que contiene la información genética y que es trans­mitida de generación en generación. Su forma es la de una doble hélice, y está constituida por cuatro tipos de bases nitrogenadas, la adenina, guanina, citosina y timina, las cuales se unen entre sí (A y T, C y G) para formar las dos cadenas antiparalelas. Además contiene un azúcar, la des­oxirribosa (que le confiere la raíz del nombre) y moléculas de fosfato, que conforman el esqueleto.

¿Qué es un gen?

Es una secuencia de adn que codifica para la formación de una proteína. El dna se transcribe, es decir, su secuen­cia es copiada por un arn (ácido ribo­nucleíco) mensajero, el cual se tradu­ce en la producción de una proteína.

¿Qué es un genoma?

Es toda la información genética que contiene una célula, y por lo tanto un individuo, ya sea una bacteria, que es un organismo unicelular, un hongo, una mariposa, un árbol, un hombre o un elefante, y es lo que le confiere todas sus características, su individua­lidad, y también se encarga de “dar las órdenes” a la célula para su co­rrecto funcionamiento. Un genoma es el conjunto completo de eslabones de dna de un organismo, las moléculas complejas que dirigen la formación y el funcionamiento de todos los seres vivos. Esta información es transmitida de la célula madre a la célula hija. En el caso de la reproducción asexual, como es el caso de las bacterias, la in­formación de la descendencia es idén­tica a la de la célula progenitora. En el caso de los otros organismos (euca­riontes), que tienen núcleo celular defi­nido y que en la mayoría de los casos presentan reproducción sexual, como las hormigas, las flores y los humanos, la mitad de su información genética es transmitida por la madre, y la otra mi­tad por el padre.

Los genomas pueden presentarse en forma de un solo cromosoma circular, como en la mayoría de las bacterias, u organizados en diferentes replicones o estructuras, y en el caso de los organis­mos eucariontes en cromosomas, que se encuentran en pares y en casos de reproducción sexual uno proviene de la madre y el otro del padre.

¿Qué es la secuenciación de genomas?

La secuenciación de un genoma con­

siste en obtener la información acerca de todos los nucleótidos, es decir, el orden en el que la adenina (A), guani­na (G), citosina (C) y timina (T) apare­cen en el genoma de un organismo en particular. A la fecha, existen cientos de genomas secuenciados y publica­dos, tanto de microorganismos (más de mil), como de plantas y animales superiores, además de la secuencia­ción del genoma humano que tanto re­vuelo causó hace ya algunos años. La medida que se utiliza para cuantificar los genomas son los pares de bases (pb, o bp, por base pairs en inglés), que son los pares de eslabones en la cadena de dna. Hay genomas tan pe­queños como el caso de Mycoplasma pneumoniae, una bacteria parásita del tracto respiratorio del humano, cuyo genoma tiene apenas 816 mil pares de bases (kpb), o tan grandes como el de Paris japonica, una planta con flores blancas, que contiene 150 millones de pares de bases (Mpb). El humano tiene alrededor de 21 mil ge­nes y la pulga del agua tiene 31 mil.

¿Qué valor tiene este conocimiento?

La secuenciación de un genoma arroja una serie enorme de miles de A, T, G y C, algo así como ATGCCTGAATTT­CAGAACCCTGATCGATAACCGCG­TAAATCG… y la pregunta aquí po­dría ser: ¿para qué nos sirve? ¿Cómo lo podemos leer? Pudiera parecer al­guna incoherencia escrita por un niño o alguien que se le ocurrió jugar una broma. La clave está en la Bioinformá­tica, sin esta poderosa herramienta se­ría muy difícil buscar las palabras al interior de dichas secuencias, siendo estas palabras los genes, sitios regula­torios, regiones de interés específico, y siguiendo la misma analogía las frases corresponderían a los operones, que son grupos de genes que contribuyen a una función o actividad específica. Al proceso de buscar el significado en las secuencias de dna se le conoce como anotación, y es esto lo que le da valor a una secuencia.

La anotación se lleva a cabo en tres etapas principales:

1) Anotación sintáctica: asignación de genes, señales regulatorias y repe­ticiones.

2) Anotación funcional: se indaga en la función biológica de los genes, así como en las familias de operones y

3) Anotación relacional: se deter­minan los módulos funcionales nece­sarios para llevar a cabo una función celular específica.

Con este efecto se emplean progra­mas y herramientas computacionales y la anotación experta es llevada a cabo tomando en cuenta la biología del organismo secuenciado (su fisiolo­gía, nicho ecológico, actividad, entre otras cosas). De la misma manera, me­diante el estudio de las vías metabóli­cas pueden buscarse los genes que es­tén posiblemente ausentes en éstas, y mediante posteriores ensayos fisiológi­cos puede comprobarse la efectividad de dicho proceso y de esta manera comprobar si la proteína está presente funcionalmente.

El estudio de los genes y los ge­nomas han llevado a descubrir cosas fascinantes, como por ejemplo el gen que codifica para la proteína verde fluorescente, conocida más común­mente como gfp por green fluorescent protein, en inglés, y cuyo descubri­miento y caracterización merecieron el Premio Nóbel de Química en 2008 a los tres investigadores, Shimomura, Chalfie y Tsien que participaron esca­lonadamente en dilucidar la estructura y función de la proteína. Fue asilada originalmente de la medusa Aequorea victoria y se utiliza en diversos cam­pos como la microbiología, ingenie­ría genética, fisiología, e ingeniería ambiental. Este gen se utiliza como un gen reportero por su fluorescencia que permite ver procesos previamente invisibles, como el desarrollo de neu­ronas, cómo se diseminan las células cancerosas, o la contaminación de agua con arsénico, por mencionar al­gunos usos.

Algunos genes de gran valor ali­menticio se han podido duplicar y reincorporar al genoma de algunas plantas para desarrollar plantas con mayor valor nutritivo. En otros casos, a algunas plantas carentes de algún nu­triente, como es el caso del arroz que carece de vitamina A, se le han incor­porado genes que producen ß carote­no (precursor de la vitamina), evitando así la ceguera causada por la falta de la misma que aqueja a cientos de mi­les de personas que viven en regiones donde es el principal alimento.

Por otro lado, se han descubierto algunos genes responsables de enfer­medades en el humano, como el dal­tonismo, que es la incapacidad para distinguir algunos colores, la hemofilia que produce dificultad en la coagula­ción de la sangre, la enfermedad de Tay-Sachs que da lugar a una degene­ración progresiva en el sistema nervio­so central, entre muchas otras.

En este sentido, un grupo de cien­tíficos encontró una alteración gené­tica en el gen HDAC9 (los humanos tenemos 23 pares de cromosomas con un total de 21 mil genes) que afecta el riesgo de las personas a sufrir una apoplejía. Esta alteración ocurre en el 10% de los cromosomas humanos y las personas que poseen dos copias de ella (heredada por ambos proge­nitores) tienen el doble del riesgo a sufrir este padecimiento que las perso­nas que no la tienen en su genoma. Con estos resultados se trabaja para desarrollar nuevos tratamientos que reduzcan el riesgo de accidentes cere­bro vasculares.

El estudio del genoma humano ha dotado al mundo herramientas tras­cendentales e innovadoras para el tratamiento y prevención de diversas enfermedades al identificar los genes responsables de ellas. La información acerca de lo que cada paciente tiene en sus genes puede ayudar a tomar decisiones importantes para hacer su tratamiento más efectivo.

Y como todos lo sabemos, con el conocimiento viene una gran respon­sabilidad, por lo que es esencial que tengamos conciencia del lugar que ocupamos en este planeta, dejemos de servirnos irracionalmente de él y más aún, procuremos ser un factor de influencia positiva sobre la vida en esta nuestra Tierra. Solo somos una es­pecie más. Todos estamos hechos de la misma materia.

La genómica tiene muchas aplica­ciones prácticas, y no debe ser más considerada una disciplina esotérica, ya que nos concierne a todos. No le perdamos la huella, ¡vale la pena!

 

Publicado en Conversus 100

Revista del Instituto Politécnico Nacional

Ayúdanos compartiendo
  •  
  •  
  •  
  •  
  •  
  •  
  •  
  •  
  •  

Autor entrada: Salvador Castell

Biólogo, entusiasta y consiente del papel de los académicos en la transmisión del conocimiento, con especial interés en métodos holísticos, integrativos, multidisciplinarios y disruptivos, basados en el principio de la entropía biológica.

Deja un comentario